Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso

Rabietou Nikiema; Amana Metuor Dabire; Olawoumi Fabrice Kouta; Eliada Benoit Lionel Bambara; Nicolas Ouedraodo; Rhaina Olivia Badini; Pegd-Wende Rose Bonkoungou

doi:doi:10.11648/j.ajbls.20251305.11

Research Article |

| Peer-Reviewed

Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso

Rabietou Nikiema^*

, Amana Metuor Dabire

, Olawoumi Fabrice Kouta

, Eliada Benoit Lionel Bambara

, Nicolas Ouedraodo

, Rhaina Olivia Badini

, Pegd-Wende Rose Bonkoungou

Published in American Journal of Biomedical and Life Sciences (Volume 13, Issue 5)

Received: 20 August 2025 Accepted: 29 August 2025 Published: 27 October 2025

Views: Downloads:

Download PDF

Share This Article

Twitter
Linked In
Facebook

Abstract

Introduction: Antibiotic resistance, particularly to quinolones, represents a major public health concern in Burkina Faso. In recent decades, plasmid-mediated quinolone resistance (PMQR) mechanisms have emerged, especially among Gram-negative bacteria. These mechanisms include, among others, qnr genes (qnrA, qnrB, qnrS). This study aimed to investigate the presence of quinolone resistance determinants in Gram-negative bacilli isolated from pus and vaginal samples at Saint Camille Hospital of Ouagadougou (HOSCO). Methodology: A total of 19 strains of Escherichia coli isolated from pus and vaginal swabs were collected for bacteriological and molecular analysis. Four antibiotics, namely ciprofloxacin (CIP), norfloxacin (NOR), ofloxacin (OF) and levofloxacin (LEV) were used for sensitivity testing and molecular analysis focused on the detection of qnrA, qnrB, and qnrS type genes. Results: Resistance rates to CIP, NOR, OF, and LEV were 57.89%, 52.63%, 52.63%, and 31.37%, respectively. Molecular analysis revealed the presence of qnrB, and qnrS genes in 28.47% of the isolates, for each gene. The qnrA gene was not detected in any isolate. The analysis of the genetic support of resistance genes revealed that 50% of the qnrS genes were plasmid-borne, while only 25% of the qnrB genes were associated with plasmids. La Correlation analysis between resistance genes and antibiotics showed a moderate positive correlation between qnrB and NOR/LEV, thereby suggesting the involvement of qnrB in resistance to these antibiotics. Conclusion: These findings highlight the need for continuous surveillance of antibiotic resistance in clinical isolates.

Published in	American Journal of Biomedical and Life Sciences (Volume 13, Issue 5)
DOI	10.11648/j.ajbls.20251305.11
Page(s)	90-97
Creative Commons	This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.
Copyright	Copyright © The Author(s), 2025. Published by Science Publishing Group

Keywords

Quinolones, Qnr Genes, Burkina Faso

1. Introduction

Quinolones are a class of broad-spectrum synthetic antimicrobial agents commonly used to treat infections caused by Gram-negative bacteria. Their primary mechanism of action involves the inhibition of DNA gyrase and topoisomerase IV, enzymes essential for bacterial DNA replication and transcription

[1]	S. Swedan, E. A. Alabdallah, et Q. Ababneh, « Resistance to aminoglycoside and quinolone drugs among Klebsiella pneumoniae clinical isolates from northern Jordan », Heliyon, vol. 10, no 1, p. e23368, déc. 2023, https://doi.org/10.1016/j.heliyon. 2023.e23368 View Article
[2]	G. A. Jacoby, « Mechanisms of Resistance to Quinolones », Clinical Infectious Diseases, vol. 41, no Supplement_2, p. S120‑S126, juill. 2005, https://doi.org/10.1086/428052 View Article
[3]	Y. Jiang et al., « Plasmid-mediated quinolone resistance determinants qnr and aac(6’)-Ib-cr in extended-spectrum -lactamase-producing Escherichia coli and Klebsiella pneumoniae in China », Journal of Antimicrobial Chemotherapy, vol. 61, no 5, p. 1003‑1006, mars 2008, https://doi.org/10.1093/jac/dkn063 View Article
[4]	L. Meradi, A. Djahoudi, A. Abdi, M. Bouchakour, J.-D. Perrier Gros Claude, et M. Timinouni, « Résistance aux quinolones de types qnr, aac (6′)-Ib-cr chez les entérobactéries isolées à Annaba en Algérie », Pathologie Biologie, vol. 59, no 4, p. e73‑e78, août 2011, https://doi.org/10.1016/j.patbio.2009.05.003 View Article
[5]	F. D. Salah et al., « Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo », Antimicrob Resist Infect Control, vol. 8, p. 104, juin 2019, https://doi.org/10.1186/s13756-019-0552-0 View Article
[6]	P. Nordmann et L. Poirel, « Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae », Journal of Antimicrobial Chemotherapy, vol. 56, no 3, p. 463‑469, sept. 2005, https://doi.org/10.1093/jac/dki245 View Article
[7]	J. A. Collins et N. Osheroff, « Gyrase and Topoisomerase IV: Recycling Old Targets for New Antibacterials to Combat Fluoroquinolone Resistance », ACS Infect Dis, vol. 10, no 4, p. 1097‑1115, avr. 2024, https://doi.org/10.1021/acsinfecdis.4c00128 View Article
[8]	K. J. Aldred, R. J. Kerns, et N. Osheroff, « Mechanism of Quinolone Action and Resistance », Biochemistry, vol. 53, no 10, p. 1565‑1574, mars 2014, https://doi.org/10.1021/bi5000564 View Article
[9]	S.-G. Kim, B.-E. Kim, J. H. Lee, et D.-W. Kim, « Novel Qnr Families as Conserved and Intrinsic Quinolone Resistance Determinants in Aeromonas spp. », J Microbiol Biotechnol, vol. 34, no 6, p. 1276‑1286, juin 2024, https://doi.org/10.4014/jmb.2403.03043 View Article

[1-9]

. For many years, quinolone resistance was believed to arise exclusively through chromosomal mechanisms—particularly mutations in genes encoding DNA gyrase and topoisomerase IV, overexpression of efflux pumps leading to active drug extrusion, and reduced outer membrane permeability due to porin loss

[10-14]

However, over the past few decades, plasmid-mediated quinolone resistance (PMQR) mechanisms have emerged, particularly among Gram-negative organisms

[15]

. These mechanisms include the qnr genes (qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC), which encode proteins that protect DNA gyrase from quinolone binding

[1, 15, 16]

; enzymes such as the aminoglycoside acetyltransferase encoded by aac(6′)-Ib-cr, which modifies certain fluoroquinolones

[1, 10, 15, 17]

; and efflux pump genes such as qepA and oqxAB, which actively expel quinolones from the bacterial cell

[8, 18, 19]

Although qnr genes alone typically confer low-level resistance, their presence facilitates the selection of additional chromosomal mutations that can lead to high-level resistance, thereby contributing to the alarming global rise in quinolone resistance

[2, 20]

In Burkina Faso, data on the distribution of quinolone resistance genes remain scarce. This study aims to contribute to the understanding of resistance profiles among Gram-negative bacilli isolated from clinical samples. Specifically, we seek to detect the presence of key plasmid-mediated quinolone resistance determinants (qnrA, qnrB and qnrS in isolates obtained from pus and vaginal specimens collected at Saint Camille Hospital of Ouagadougou (HOSCO).

2. Methodology

2.1. Sample Collection

A total of 19 clinical samples—including 14 pus samples and 5 vaginal swabs—were collected from patients at Saint Camille Hospital of Ouagadougou (HOSCO) over a one-month period, from March to April 2024.

2.2. Bacteriological Analysis

Samples were subjected to standard bacteriological procedures, including macroscopic examination, inoculation and incubation, microscopic observation, bacterial isolation, identification, and antibiotic susceptibility testing. Bacterial isolation was performed on Eosin Methylene Blue selective agar. Once isolated, bacterial strains were identified using biochemical assays, specifically the API 20E system, according to the manufacturer’s instructions.

Antimicrobial susceptibility testing was conducted using the disc diffusion method on Mueller-Hinton agar, in accordance with the guidelines of the French Society for Microbiology's Antibiogram Committee (CASFM). The antibiotics tested included ciprofloxacin (CIP), norfloxacin (NOR), levofloxacin (LEV), and ofloxacin (OF).

2.3. Bacterial DNA Extraction

Genomic DNA was extracted from the isolated bacterial strains using the boiling method. Bacterial cells were lysed by heating at 100°C to release their genetic material. The lysate was then centrifuged to remove cellular debris, and the supernatant containing DNA was collected. DNA concentration and purity were measured using a Nanodrop spectrophotometer prior to PCR amplification.

2.4. Polymerase Chain Reaction (PCR)

Table 1. Primer sequences used for the detection of quinolone resistance genes.

Genes

Primer Sequences (5' → 3')

Amplicon Size (bp)

References

qnrA

For: ATTTCTCACGCCAGGATTTG

516 bp

[21]

Rev: GATCGGCAAAGGTTAGGTCA

qnrB

For: GATCGTGAAAGCCAGAAAGG

469 bp

[21]

Rev.: ACGATGCCTGGTAGTTGTCC

qnrS

For: ACGACATTCGTCAACTGCAA

417 bp

[21]

Rev: TAAATTGGCACCCTGTAGGC

Conventional PCR was employed to detect the presence of quinolone resistance genes (qnrA, qnrB and qnrS, using gene-specific primers (see Table 1). Amplified products were subsequently visualized via agarose gel electrophoresis.

2.5. Plasmid DNA Extraction

In order to determine the genetic support of the identified resistance genes, plasmid DNA extraction was performed on the strains harboring at least one of the targeted genes. The alkaline lysis method was employed for this purpose. Following plasmid quantification, conventional PCR was carried out using the primers previously described (Table 1).

2.6. Data Analysis

Data were compiled using Microsoft Excel and statistically analyzed with R software, version 4.3.3.

3. Results

Antibiotic susceptibility testing was conducted for four fluoroquinolones: ciprofloxacin (CIP), levofloxacin (LEV), ofloxacin (OF), and norfloxacin (NOR). The presence of quinolone resistance genes—qnrA, qnrB and qnrS, was also assessed. Molecular analysis was performed on bacterial isolates exhibiting resistance to at least one of the tested antibiotics.

3.1. Distribution of Bacterial Species

The analysis of bacterial species distribution (Table 2) revealed that Escherichia coli was the most prevalent species, identified in 10 isolates (7 from pus samples and 3 from vaginal swabs). Klebsiella pneumoniae was detected in 5 isolates (3 pus, 2 vaginal), followed by Pseudomonas aeruginosa in 3 isolates (all from pus), and Proteus mirabilis in a single isolate (pus).

Table 2. Distribution of Bacterial Species.

Species	Pus samples	Vaginal swabs
E. coli	7	3
K. pneumoniae	3	2
P. aeruginosa	3	0
P. mirabilis	1	0

3.2. Antibiotic Resistance Profile

The results of the antibiotic susceptibility testing (Table 3) revealed considerable variability in resistance rates depending on the antibiotic tested.

Table 3. Antibiotic Susceptibility Profile.

Identification Number	Sex	Bacterial Species	CIP	LEV	OF	NOR
Pus 2	M	K. pneumoniae	S	S	R	S
Pus 11	F	P. aeruginosa	R	S	S	R
Pus 10	M	E. coli	R	R	R	R
Pus 1	M	E. coli	R	R	R	S
PV32	F	K. pneumoniae	R	S	R	R
PUS 5931	F	E. coli	R	R	R	R
PUS42	F	E. coli	R	R	R	R
PV2	M	E. coli	R	S	S	R
Pus 9	M	P. mirabilis	S	R	R	S
Pus 8	F	K. pneumoniae	R	R	R	R
Pus 5	F	E. coli	S	S	S	S
Pus 4	M	P. aeruginosa	R	S	S	R
Pus 3	M	E. coli	R	S	R	R
Pus 12	F	E. coli	R	S	R	R
PV32	F	E. coli	S	S	S	S
PV12	F	K. pneumoniae	S	S	S	S
PV 1	M	E. coli	S	S	S	S
Pus 7	M	K. pneumoniae	S	S	S	S
Pus 6	F	P. aeruginosa	S	S	S	S

This table demonstrates a high level of resistance to ciprofloxacin (CIP), with 11 resistant isolates (57.9%), followed by ofloxacin (OF) and norfloxacin (NOR), each exhibiting resistance in 10 isolates (52.63%). Levofloxacin (LEV) showed a moderate resistance level, with 6 resistant isolates (31.6%).

Table 4. Distribution of Resistance Genes.

Genes	Presence/Absence	Frequency	Total	Percentage
qnrA	Négative	14	14	100
qnrB	Négative	10	14	71.4
qnrB	Positive	4	14	28.6
qnrS	Négative	10	14	71,4
qnrS	Négative	4	14	28,6

The table above reports, for each resistance gene (qnrA, qnrB, qnrS), the number of bacterial isolates identified as either "Positive" or "Negative." The qnrB and qnrS genes exhibited the same distribution pattern, each being present in 4 isolates (28.6%) and absent in 10. In contrast, the qnrA gene was not detected in any of the tested isolates. The PCR results, as illustrated by the images obtained, are shown in Figure 1.

Download: Download full-size image

Figure 1. Visualization of PCR Amplification Products by Agarose Gel Electrophoresis.

3.3. Genetic Support of Resistance Genes

The test for determining the genetic support of resistance genes yielded the following results:

Table 5. Genetic Support Assessment of Antimicrobial Resistance Genes.

Genes	Positive	Negative
P-qnrS	2 (50%)	2 (50%)
p-qnrB	1 (25%)	3 (75%)

As shown in Table 5 above, among the four qnrS-type genes identified, 50% were carried by plasmids. In contrast, only 25% of the qnrB-type genes were found to be plasmid-borne.

3.4. Correlation Between Resistance Genes and Antibiotic Susceptibility

The correlation analysis between resistance genes and antibiotic susceptibility profiles (Figure 2) revealed a significant positive correlation between qnrB and NOR (r = 0.40), as well as with LEV (r = 0.33). Conversely, a strong negative correlation was observed between qnrS and OF (r = –0.548).

Download: Download full-size image

Figure 2. Heatmap of Correlations Between Resistance Genes and Antibiotics.

The heatmap illustrates strong positive correlations (in blue), strong negative correlations (in red), and weak or negligible correlations (in white).

4. Discussion

The emergence of antibiotic-resistant bacteria, particularly those resistant to quinolones, poses a serious threat to the effectiveness of antimicrobial agents that have revolutionized medicine and saved millions of lives

[22, 23]

. This challenge is particularly alarming in low-resource countries such as Burkina Faso, where infectious diseases, poverty, and malnutrition remain endemic

[24]

. Prompt administration of appropriate antimicrobial therapy is essential for effective infection management. Empirical treatment strategies must therefore be informed by a thorough understanding of the pathogens involved and their resistance profiles

[25]

The aim of this study was to assess the prevalence of fluoroquinolone resistance among Gram-negative bacilli and to identify the associated resistance genes. Among the isolates analyzed, E. coli was the most frequently detected species (52.63%), a finding consistent with several previous studies

[26-31]

. However, other reports have identified K. pneumoniae as the dominant species

[32, 33]

In the present study, high resistance rates were observed for ciprofloxacin (CIP, 57.89%), norfloxacin (NOR, 52.63%), and ofloxacin (OF, 52.63%), with levofloxacin (LEV) exhibiting a comparatively lower resistance rate (31.37%). Similar trends have been reported elsewhere—for example, Swedan et al. found ciprofloxacin resistance to be predominant in Jordan

[1]

, while Rafya et al. reported a high resistance rate to levofloxacin (93.4%) in Iraq

[22]

. Differences across studies may be attributed to various factors, including population socio-economic characteristics, methodological differences, antibiotic accessibility, patterns of antibiotic misuse, and the clinical origin of the isolates.

Among the known mechanisms of fluoroquinolone resistance, plasmid-mediated resistance is one of the most recently identified

[17]

. This study specifically investigated three qnr genes (qnrA, qnrB, qnrS). The qnrB and qnrS genes were each detected in 28.57% of the isolates, while qnrA was not detected in any sample. These frequencies are lower than those reported in a study from Togo, where the prevalence of qnrB, qnrS, and qnrA was 47.74%, 47.10%, and 2.58%, respectively

[5]

. In studies conducted in Morocco

[31]

, Mexico

[34]

, and Côte d’Ivoire

[13]

, qnrB was the most commonly identified gene.

In our dataset, qnr gene prevalence was highest in E. coli isolates (28.57%). This contrasts with studies from Tunisia and South Korea, where K. pneumoniae exhibited a significantly higher prevalence of qnr genes (up to 80%)

[19, 35]

. Such discrepancies may reflect regional variation in circulating resistance genes and phenotypes, as well as differences in sample size and bacterial strain distribution. The analysis of the genetic support of resistance genes revealed that 50% of the qnrS genes were plasmid-borne, while only 25% of the qnrB genes were associated with plasmids. However, several studies have reported and confirmed that qnr genes are typically carried by plasmids

[1, 15, 16]

. This discrepancy could be explained by the possibility that the bacterial strain under investigation may have lost the plasmid carrying the qnr gene during culture or isolation. Additionally, the qnr gene may be located on other mobile genetic elements, such as transposons or integrons, which are not necessarily plasmid-associated but can still facilitate chromosomal integration. It is also possible that qnr genes are directly integrated into the bacterial chromosome rather than being carried by mobile genetic elements such as plasmids.

We also conducted a correlation analysis to explore potential relationships between resistance genes and the antibiotics to which they confer resistance. A significant positive correlation was found between qnrB and both NOR (r = 0.40) and LEV (r = 0.33). Conversely, qnrS showed a strong negative correlation with OF. The observed positive correlation supports the role of qnrB in resistance to NOR and LEV. Meanwhile, the negative correlation suggests the presence of alternative resistance mechanisms, such as chromosomal mutations in genes encoding DNA gyrase or overexpression of efflux pumps

[4, 36]

5. Conclusion

This study investigated quinolone resistance in various Gram-negative bacilli isolated from pus and vaginal swab samples. A high prevalence of resistance to ciprofloxacin, norfloxacin, and ofloxacin was observed. Additionally, a significant presence of specific resistance genes (qnrB, qnrS) was noted. These findings underscore the importance of continuous monitoring of antibiotic resistance in clinical isolates to inform effective antimicrobial stewardship.

Abbreviations

HOSCO	Saint Camille Hospital of Ouagadougou
PMQR	Plasmid-Mediated Quinolone Resistance
CIP	Ciprofloxacin
NOR	Norfloxacin
LEV	Levofloxacin
OF	Ofloxacin
DNA	Deoxyribonucleic Acid
EMB	Eosin Methylene Blue
CASFM	French Society for Microbiology's Antibiogram Committee

Acknowledgments

The author wishes to thank all study participants and extends sincere gratitude to the staff of Saint Camille Hospital of Ouagadougou for their support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1]	S. Swedan, E. A. Alabdallah, et Q. Ababneh, « Resistance to aminoglycoside and quinolone drugs among Klebsiella pneumoniae clinical isolates from northern Jordan », Heliyon, vol. 10, no 1, p. e23368, déc. 2023, https://doi.org/10.1016/j.heliyon. 2023.e23368
[2]	G. A. Jacoby, « Mechanisms of Resistance to Quinolones », Clinical Infectious Diseases, vol. 41, no Supplement_2, p. S120‑S126, juill. 2005, https://doi.org/10.1086/428052
[3]	Y. Jiang et al., « Plasmid-mediated quinolone resistance determinants qnr and aac(6’)-Ib-cr in extended-spectrum -lactamase-producing Escherichia coli and Klebsiella pneumoniae in China », Journal of Antimicrobial Chemotherapy, vol. 61, no 5, p. 1003‑1006, mars 2008, https://doi.org/10.1093/jac/dkn063
[4]	L. Meradi, A. Djahoudi, A. Abdi, M. Bouchakour, J.-D. Perrier Gros Claude, et M. Timinouni, « Résistance aux quinolones de types qnr, aac (6′)-Ib-cr chez les entérobactéries isolées à Annaba en Algérie », Pathologie Biologie, vol. 59, no 4, p. e73‑e78, août 2011, https://doi.org/10.1016/j.patbio.2009.05.003
[5]	F. D. Salah et al., « Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo », Antimicrob Resist Infect Control, vol. 8, p. 104, juin 2019, https://doi.org/10.1186/s13756-019-0552-0
[6]	P. Nordmann et L. Poirel, « Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae », Journal of Antimicrobial Chemotherapy, vol. 56, no 3, p. 463‑469, sept. 2005, https://doi.org/10.1093/jac/dki245
[7]	J. A. Collins et N. Osheroff, « Gyrase and Topoisomerase IV: Recycling Old Targets for New Antibacterials to Combat Fluoroquinolone Resistance », ACS Infect Dis, vol. 10, no 4, p. 1097‑1115, avr. 2024, https://doi.org/10.1021/acsinfecdis.4c00128
[8]	K. J. Aldred, R. J. Kerns, et N. Osheroff, « Mechanism of Quinolone Action and Resistance », Biochemistry, vol. 53, no 10, p. 1565‑1574, mars 2014, https://doi.org/10.1021/bi5000564
[9]	S.-G. Kim, B.-E. Kim, J. H. Lee, et D.-W. Kim, « Novel Qnr Families as Conserved and Intrinsic Quinolone Resistance Determinants in Aeromonas spp. », J Microbiol Biotechnol, vol. 34, no 6, p. 1276‑1286, juin 2024, https://doi.org/10.4014/jmb.2403.03043
[10]	M. Goudarzi, M. Azad, et S. S. Seyedjavadi, « Prevalence of Plasmid-Mediated Quinolone Resistance Determinants and OqxAB Efflux Pumps among Extended-Spectrum β -Lactamase Producing Klebsiella pneumoniae Isolated from Patients with Nosocomial Urinary Tract Infection in Tehran, Iran », Scientifica, vol. 2015, p. 1‑7, 2015, https://doi.org/10.1155/2015/518167
[11]	M. Goudarzi et M. Fazeli, « Quinolone Resistance Determinants qnr, qep, and aac(6’)-Ib-cr in Extended-Spectrum Β-Lactamase Producing Escherichia coli Isolated From Urinary Tract Infections in Tehran, Iran », Shiraz E-Med J, vol. 18, no 5, Art. no 5, 2017, https://doi.org/10.5812/semj.44498
[12]	L. Jamali et al., « Prévalence des gènes de résistance plasmidique aux quinolones chez des entérobactéries communautaires isolées au Maroc », ISSN 2351-8014 Vol. 11 No. 2 Nov. 2014, pp. 387-399.
[13]	N. Guessennd et al., « Résistance aux quinolones de type qnr chez les entérobactéries productrices de bêta-lactamases à spectre élargi à Abidjan en Côte d’Ivoire », Pathologie Biologie, vol. 56, no 7, p. 439‑446, nov. 2008, https://doi.org/10.1016/j.patbio.2008.07.025
[14]	P. Nordmann et H. Mammeri, « Résistance plasmidique aux quinolones », Antibiotiques, vol. 9, no 4, p. 246‑253, déc. 2007, https://doi.org/10.1016/S1294-5501(07)73921-3
[15]	M. Gharbi, M. A. S. Abbas, S. Hamrouni, et A. Maaroufi, « First Report of aac(6′)-Ib and aac(6′)-Ib-cr Variant Genes Associated with Mutations in gyrA Encoded Fluoroquinolone Resistance in Avian Campylobacter coli Strains Collected in Tunisia », Int J Mol Sci, vol. 24, no 22, p. 16116, nov. 2023, https://doi.org/10.3390/ijms242216116
[16]	M. J. Pons, C. Gomes, et J. Ruiz, « QnrVC, a new transferable Qnr-like family », Enferm Infecc Microbiol Clin, vol. 31, no 3, p. 191‑192, mars 2013, https://doi.org/10.1016/j.eimc.2012.09.008
[17]	B. Javadi, K. Kafshdouzan, S. H. Emadi Chashmi, et O. Pazhand, « Plasmid-mediated quinolone resistance in Escherichia coli isolates from commercial broiler chickens in Semnan, Iran », Iran J Microbiol, vol. 16, no 2, p. 193‑200, avr. 2024, https://doi.org/10.18502/ijm.v16i2.15352
[18]	U. O. Kibwana et al., « Fluoroquinolone resistance among fecal extended spectrum βeta lactamases positive Enterobacterales isolates from children in Dar es Salaam, Tanzania », BMC Infect Dis, vol. 23, no 1, p. 135, mars 2023, https://doi.org/10.1186/s12879-023-08086-2
[19]	S. Ferjani, M. Saidani, F. S. Amine, et I. Boutiba-Ben Boubaker, « Prevalence and Characterization of Plasmid-Mediated Quinolone Resistance Genes in Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in a Tunisian Hospital », Microbial Drug Resistance, vol. 21, no 2, p. 158‑166, avr. 2015, https://doi.org/10.1089/mdr.2014.0053
[20]	J. Strahilevitz, G. A. Jacoby, D. C. Hooper, et A. Robicsek, « Plasmid-Mediated Quinolone Resistance: a Multifaceted Threat », Clinical Microbiology Reviews, vol. 22, no 4, p. 664‑689, oct. 2009, https://doi.org/10.1128/cmr.00016-09
[21]	A. Robicsek et al., « Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase », Nat Med, vol. 12, no 1, p. 83‑88, janv. 2006, https://doi.org/10.1038/nm1347
[22]	« Quinolone resistance (qnrA) gene in isolates of Escherichia coli collected from the Al-Hillah River in Babylon Province, Iraq », Pharmacia, vol. 68, no 1, p. 1‑7, janv. 2021, https://doi.org/10.3897/pharmacia.68.e57819
[23]	C. L. Ventola, « The Antibiotic Resistance Crisis », P T, vol. 40, no 4, p. 277‑283, avr. 2015.
[24]	A. S. Ouedraogo, H. Jean Pierre, A. L. Bañuls, R. Ouédraogo, et S. Godreuil, « Emergence and spread of antibiotic resistance in West Africa: contributing factors and threat assessment », Médecine et Santé Tropicales, vol. 27, no 2, p. 147‑154, mai 2017, https://doi.org/10.1684/mst.2017.0678
[25]	H. S. Sader, M. Castanheira, et R. K. Flamm, « Antimicrobial Activity of Ceftazidime-Avibactam against Gram-Negative Bacteria Isolated from Patients Hospitalized with Pneumonia in U.S. Medical Centers, 2011 to 2015 », Antimicrob Agents Chemother, vol. 61, no 4, p. e02083-16, mars 2017, https://doi.org/10.1128/AAC.02083-16
[26]	Salmanov AG, Vitiuk AD, Hrynchuk SY, Bober AS, Hrynchuk OB, Berestooy OA, Chernega TV, Rud vo. vaginal cuff infection after hysterectomy in ukraine. Wiad Lek. 2021; 74(2): 196-201. PMID: 33813471.
[27]	I. A. Elegbe, A. A. Adefioye, et I. Elegbe, « Aerobic urethral flora of women with infertility and gynecologic problems », Int J Gynaecol Obstet, vol. 21, no 3, p. 241‑245, juin 1983, https://doi.org/10.1016/0020-7292(83)90087-5
[28]	C. A. Devi, A. Ranjani, D. Dhanasekaran, N. Thajuddin, et T. Ramanidevi, « Surveillance of multidrug resistant bacteria pathogens from female infertility cases », African Journal of Biotechnology, vol. 12, no 26, Art. no 26, 2013, https://doi.org/10.5897/AJB2013.12507M
[29]	Ghiasi, H. Fazaeli, N. Kalhor, M. Sheykh-Hasan, et R. Tabatabaei-Qomi, « Assessing the prevalence of bacterial vaginosis among infertile women of Qom city », Iran J Microbiol, vol. 6, no 6, p. 404‑408, déc. 2014.
[30]	S. Abrar, A. Vajeeha, N. Ul-Ain, et S. Riaz, « Distribution of CTX-M group I and group III β-lactamases produced by Escherichia coli and klebsiella pneumoniae in Lahore, Pakistan », Microbial Pathogenesis, vol. 103, p. 8‑12, févr. 2017, https://doi.org/10.1016/j.micpath.2016.12.004
[31]	M. Bouchakour et al., « Plasmid-mediated quinolone resistance in expanded spectrum beta lactamase producing enterobacteriaceae in Morocco », The Journal of Infection in Developing Countries, vol. 4, no 12, Art. no 12, août 2010, https://doi.org/10.3855/jidc.796
[32]	H. Ejaz et al., « The Rising Tide of Antibiotic Resistance: A Study on Extended-Spectrum Beta-Lactamase and Carbapenem-Resistant Escherichia coli and Klebsiella pneumoniae », Journal of Clinical Laboratory Analysis, vol. 38, no 10, p. e25081, 2024, https://doi.org/10.1002/jcla.25081
[33]	Hrabák J, Študentová V, Jakubů V, Adámková V, Dvořáková L, Balejova M, Bergerová T, Chmelařová E, Ježek P, Kabelíková P, Kolář M, Paterová P, Tejkalová R, Papagiannitsis C, Žemličková H. Prevalence study on carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolates in Czech hospitals--results from Czech Part of European Survey on Carbapenemase--Producing Enterobacteriaceae (EuSCAPE). Epidemiol Mikrobiol Imunol. 2015 Jun; 64(2): 87-91. PMID: 260996.
[34]	J. Silva-Sanchez et al., « Prevalence and characterization of plasmid-mediated quinolone resistance genes in extended-spectrum β-lactamase-producing Enterobacteriaceae isolates in Mexico », Microb Drug Resist, vol. 17, no 4, p. 497‑505, déc. 2011, https://doi.org/10.1089/mdr.2011.0086
[35]	H. Y. Kang, M. D. Tamang, S. Y. Seol, et J. Kim, « Dissemination of Plasmid-mediated qnr, aac(6’)-Ib-cr, and qepA Genes Among 16S rRNA Methylase Producing Enterobacteriaceae in Korea », J Bacteriol Virol, vol. 39, no 3, p. 173, 2009, https://doi.org/10.4167/jbv.2009.39.3.173
[36]	C. M. Nsofor, M. Y. Tattfeng, et C. A. Nsofor, « High prevalence of qnrA and qnrB genes among fluoroquinolone-resistant Escherichia coli isolates from a tertiary hospital in Southern Nigeria », Bulletin of the National Research Centre, vol. 45, no 1, p. 26, janv. 2021, https://doi.org/10.1186/s42269-020-00475-w

Cite This Article

Plain Text BibTeX RIS

APA Style

Nikiema, R., Dabire, A. M., Kouta, O. F., Bambara, E. B. L., Ouedraodo, N., et al. (2025). Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso. American Journal of Biomedical and Life Sciences, 13(5), 90-97. https://doi.org/10.11648/j.ajbls.20251305.11

Copy | Download

ACS Style

Nikiema, R.; Dabire, A. M.; Kouta, O. F.; Bambara, E. B. L.; Ouedraodo, N., et al. Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso. Am. J. Biomed. Life Sci. 2025, 13(5), 90-97. doi: 10.11648/j.ajbls.20251305.11

Copy | Download

AMA Style

Nikiema R, Dabire AM, Kouta OF, Bambara EBL, Ouedraodo N, et al. Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso. Am J Biomed Life Sci. 2025;13(5):90-97. doi: 10.11648/j.ajbls.20251305.11

Copy | Download

@article{10.11648/j.ajbls.20251305.11,
  author = {Rabietou Nikiema and Amana Metuor Dabire and Olawoumi Fabrice Kouta and Eliada Benoit Lionel Bambara and Nicolas Ouedraodo and Rhaina Olivia Badini and Pegd-Wende Rose Bonkoungou},
  title = {Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso
},
  journal = {American Journal of Biomedical and Life Sciences},
  volume = {13},
  number = {5},
  pages = {90-97},
  doi = {10.11648/j.ajbls.20251305.11},
  url = {https://doi.org/10.11648/j.ajbls.20251305.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ajbls.20251305.11},
  abstract = {Introduction: Antibiotic resistance, particularly to quinolones, represents a major public health concern in Burkina Faso. In recent decades, plasmid-mediated quinolone resistance (PMQR) mechanisms have emerged, especially among Gram-negative bacteria. These mechanisms include, among others, qnr genes (qnrA, qnrB, qnrS). This study aimed to investigate the presence of quinolone resistance determinants in Gram-negative bacilli isolated from pus and vaginal samples at Saint Camille Hospital of Ouagadougou (HOSCO). Methodology: A total of 19 strains of Escherichia coli isolated from pus and vaginal swabs were collected for bacteriological and molecular analysis. Four antibiotics, namely ciprofloxacin (CIP), norfloxacin (NOR), ofloxacin (OF) and levofloxacin (LEV) were used for sensitivity testing and molecular analysis focused on the detection of qnrA, qnrB, and qnrS type genes. Results: Resistance rates to CIP, NOR, OF, and LEV were 57.89%, 52.63%, 52.63%, and 31.37%, respectively. Molecular analysis revealed the presence of qnrB, and qnrS genes in 28.47% of the isolates, for each gene. The qnrA gene was not detected in any isolate. The analysis of the genetic support of resistance genes revealed that 50% of the qnrS genes were plasmid-borne, while only 25% of the qnrB genes were associated with plasmids. La Correlation analysis between resistance genes and antibiotics showed a moderate positive correlation between qnrB and NOR/LEV, thereby suggesting the involvement of qnrB in resistance to these antibiotics. Conclusion: These findings highlight the need for continuous surveillance of antibiotic resistance in clinical isolates.
},
 year = {2025}
}

Copy | Download

TY  - JOUR
T1  - Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso

AU  - Rabietou Nikiema
AU  - Amana Metuor Dabire
AU  - Olawoumi Fabrice Kouta
AU  - Eliada Benoit Lionel Bambara
AU  - Nicolas Ouedraodo
AU  - Rhaina Olivia Badini
AU  - Pegd-Wende Rose Bonkoungou
Y1  - 2025/10/27
PY  - 2025
N1  - https://doi.org/10.11648/j.ajbls.20251305.11
DO  - 10.11648/j.ajbls.20251305.11
T2  - American Journal of Biomedical and Life Sciences
JF  - American Journal of Biomedical and Life Sciences
JO  - American Journal of Biomedical and Life Sciences
SP  - 90
EP  - 97
PB  - Science Publishing Group
SN  - 2330-880X
UR  - https://doi.org/10.11648/j.ajbls.20251305.11
AB  - Introduction: Antibiotic resistance, particularly to quinolones, represents a major public health concern in Burkina Faso. In recent decades, plasmid-mediated quinolone resistance (PMQR) mechanisms have emerged, especially among Gram-negative bacteria. These mechanisms include, among others, qnr genes (qnrA, qnrB, qnrS). This study aimed to investigate the presence of quinolone resistance determinants in Gram-negative bacilli isolated from pus and vaginal samples at Saint Camille Hospital of Ouagadougou (HOSCO). Methodology: A total of 19 strains of Escherichia coli isolated from pus and vaginal swabs were collected for bacteriological and molecular analysis. Four antibiotics, namely ciprofloxacin (CIP), norfloxacin (NOR), ofloxacin (OF) and levofloxacin (LEV) were used for sensitivity testing and molecular analysis focused on the detection of qnrA, qnrB, and qnrS type genes. Results: Resistance rates to CIP, NOR, OF, and LEV were 57.89%, 52.63%, 52.63%, and 31.37%, respectively. Molecular analysis revealed the presence of qnrB, and qnrS genes in 28.47% of the isolates, for each gene. The qnrA gene was not detected in any isolate. The analysis of the genetic support of resistance genes revealed that 50% of the qnrS genes were plasmid-borne, while only 25% of the qnrB genes were associated with plasmids. La Correlation analysis between resistance genes and antibiotics showed a moderate positive correlation between qnrB and NOR/LEV, thereby suggesting the involvement of qnrB in resistance to these antibiotics. Conclusion: These findings highlight the need for continuous surveillance of antibiotic resistance in clinical isolates.

VL  - 13
IS  - 5
ER  -

Copy | Download

Author Information

Rabietou Nikiema

Biochemistry-Microbiology-Molecular Biology and Genetics, Joseph Ki-Zerbo University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0007-3679-2571
Amana Metuor Dabire

Department of Biochemistry-Microbiology, University Joseph Ki-Zerbo, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0000-0002-3898-4725
Olawoumi Fabrice Kouta

Biochemistry-Microbiology-Molecular Biology and Genetics, Joseph Ki-Zerbo University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0000-5111-9982
Eliada Benoit Lionel Bambara

Biochemistry-Microbiology-Molecular Biology and Genetics, Joseph Ki-Zerbo University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0008-6549-3068
Nicolas Ouedraodo

National Malaria Research and Training Centre (CNRFP), Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0000-0001-8705-990X
Rhaina Olivia Badini

Biochemistry-Microbiology-Molecular Biology and Genetics, Joseph Ki-Zerbo University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0007-5687-3387
Pegd-Wende Rose Bonkoungou

Biochemistry-Microbiology-Molecular Biology and Genetics, Joseph Ki-Zerbo University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0006-5089-4622

Download PDF

Submit an Article

Plain Text BibTeX RIS

APA Style

Nikiema, R., Dabire, A. M., Kouta, O. F., Bambara, E. B. L., Ouedraodo, N., et al. (2025). Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso. American Journal of Biomedical and Life Sciences, 13(5), 90-97. https://doi.org/10.11648/j.ajbls.20251305.11

Copy | Download

ACS Style

Nikiema, R.; Dabire, A. M.; Kouta, O. F.; Bambara, E. B. L.; Ouedraodo, N., et al. Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso. Am. J. Biomed. Life Sci. 2025, 13(5), 90-97. doi: 10.11648/j.ajbls.20251305.11

Copy | Download

AMA Style

Nikiema R, Dabire AM, Kouta OF, Bambara EBL, Ouedraodo N, et al. Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso. Am J Biomed Life Sci. 2025;13(5):90-97. doi: 10.11648/j.ajbls.20251305.11

Copy | Download

@article{10.11648/j.ajbls.20251305.11,
  author = {Rabietou Nikiema and Amana Metuor Dabire and Olawoumi Fabrice Kouta and Eliada Benoit Lionel Bambara and Nicolas Ouedraodo and Rhaina Olivia Badini and Pegd-Wende Rose Bonkoungou},
  title = {Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso
},
  journal = {American Journal of Biomedical and Life Sciences},
  volume = {13},
  number = {5},
  pages = {90-97},
  doi = {10.11648/j.ajbls.20251305.11},
  url = {https://doi.org/10.11648/j.ajbls.20251305.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ajbls.20251305.11},
  abstract = {Introduction: Antibiotic resistance, particularly to quinolones, represents a major public health concern in Burkina Faso. In recent decades, plasmid-mediated quinolone resistance (PMQR) mechanisms have emerged, especially among Gram-negative bacteria. These mechanisms include, among others, qnr genes (qnrA, qnrB, qnrS). This study aimed to investigate the presence of quinolone resistance determinants in Gram-negative bacilli isolated from pus and vaginal samples at Saint Camille Hospital of Ouagadougou (HOSCO). Methodology: A total of 19 strains of Escherichia coli isolated from pus and vaginal swabs were collected for bacteriological and molecular analysis. Four antibiotics, namely ciprofloxacin (CIP), norfloxacin (NOR), ofloxacin (OF) and levofloxacin (LEV) were used for sensitivity testing and molecular analysis focused on the detection of qnrA, qnrB, and qnrS type genes. Results: Resistance rates to CIP, NOR, OF, and LEV were 57.89%, 52.63%, 52.63%, and 31.37%, respectively. Molecular analysis revealed the presence of qnrB, and qnrS genes in 28.47% of the isolates, for each gene. The qnrA gene was not detected in any isolate. The analysis of the genetic support of resistance genes revealed that 50% of the qnrS genes were plasmid-borne, while only 25% of the qnrB genes were associated with plasmids. La Correlation analysis between resistance genes and antibiotics showed a moderate positive correlation between qnrB and NOR/LEV, thereby suggesting the involvement of qnrB in resistance to these antibiotics. Conclusion: These findings highlight the need for continuous surveillance of antibiotic resistance in clinical isolates.
},
 year = {2025}
}

Copy | Download

TY  - JOUR
T1  - Characterization of Quinolone Resistance Genes in Gram-Negative Bacilli Isolated from Pus and Vaginal Swabs at Saint Camille Hospital, Ouagadougou (HOSCO), Burkina Faso

AU  - Rabietou Nikiema
AU  - Amana Metuor Dabire
AU  - Olawoumi Fabrice Kouta
AU  - Eliada Benoit Lionel Bambara
AU  - Nicolas Ouedraodo
AU  - Rhaina Olivia Badini
AU  - Pegd-Wende Rose Bonkoungou
Y1  - 2025/10/27
PY  - 2025
N1  - https://doi.org/10.11648/j.ajbls.20251305.11
DO  - 10.11648/j.ajbls.20251305.11
T2  - American Journal of Biomedical and Life Sciences
JF  - American Journal of Biomedical and Life Sciences
JO  - American Journal of Biomedical and Life Sciences
SP  - 90
EP  - 97
PB  - Science Publishing Group
SN  - 2330-880X
UR  - https://doi.org/10.11648/j.ajbls.20251305.11
AB  - Introduction: Antibiotic resistance, particularly to quinolones, represents a major public health concern in Burkina Faso. In recent decades, plasmid-mediated quinolone resistance (PMQR) mechanisms have emerged, especially among Gram-negative bacteria. These mechanisms include, among others, qnr genes (qnrA, qnrB, qnrS). This study aimed to investigate the presence of quinolone resistance determinants in Gram-negative bacilli isolated from pus and vaginal samples at Saint Camille Hospital of Ouagadougou (HOSCO). Methodology: A total of 19 strains of Escherichia coli isolated from pus and vaginal swabs were collected for bacteriological and molecular analysis. Four antibiotics, namely ciprofloxacin (CIP), norfloxacin (NOR), ofloxacin (OF) and levofloxacin (LEV) were used for sensitivity testing and molecular analysis focused on the detection of qnrA, qnrB, and qnrS type genes. Results: Resistance rates to CIP, NOR, OF, and LEV were 57.89%, 52.63%, 52.63%, and 31.37%, respectively. Molecular analysis revealed the presence of qnrB, and qnrS genes in 28.47% of the isolates, for each gene. The qnrA gene was not detected in any isolate. The analysis of the genetic support of resistance genes revealed that 50% of the qnrS genes were plasmid-borne, while only 25% of the qnrB genes were associated with plasmids. La Correlation analysis between resistance genes and antibiotics showed a moderate positive correlation between qnrB and NOR/LEV, thereby suggesting the involvement of qnrB in resistance to these antibiotics. Conclusion: These findings highlight the need for continuous surveillance of antibiotic resistance in clinical isolates.

VL  - 13
IS  - 5
ER  -

Copy | Download