Browse

Journals By Subject

Life Sciences, Agriculture & Food
Chemistry
Medicine & Health
Materials Science
Mathematics & Physics
Electrical & Computer Science
Earth, Energy & Environment
Architecture & Civil Engineering
Education
Economics & Management
Humanities & Social Sciences
Multidisciplinary

Books

Publish Conference Abstract Books
Upcoming Conference Abstract Books
Published Conference Abstract Books
Publish Your Books
Upcoming Books
Published Books

Proceedings

Events

Events
Five Types of Conference Publications

Join

Join as Editorial Board Member
Become a Reviewer

Information

For Authors
For Reviewers
For Editors
For Conference Organizers
For Librarians
Article Processing Charges
Special Issue Guidelines
Editorial Process
Manuscript Transfers
Peer Review at SciencePG
Open Access
Copyright and License
Ethical Guidelines
Submit an Article
Research Article | | Peer-Reviewed

Diversity of the Ralstonia Solanacearum Species of Potato Seeds in Mali

Binta Diallo,  Adounigna Kassogué,  Rokiatou Fané,  Moctar Coulibaly,  Sognan Dao,  Ibrahima Mallé,  Amadou Hamadoun Babana*
Published in International Journal of Microbiology and Biotechnology (Volume 9, Issue 3)
Received: 27 May 2024     Accepted: 24 June 2024     Published: 8 July 2024
Views:       Downloads:
Download PDF
Abstract

Potato brown rot was classified as a quarantine disease because of the complexity of the pathogen Ralstonia solanacearum L., formerly called Pseudonomas or Burkholderia solanacearum. This same bacterium causes the disease bacterial wilt. It is a multifaceted bacterium hence the complex name Ralstonia solanacearum (CeRs or RASLSSO) or BW (in English). It attacks several plant families, notably nightshades such as potatoes; the tomato; eggplant; chili pepper; tobacco…etc. The potato is the most cultivated plant worldwide. Mali is the second largest producer in West Africa after Nigeria. It imports more than 9,000 to 11,000 tons of seeds each year. Potato cultivation is faced with several biotic and abiotic attacks. Among all these attacks, those caused by bacteria cause the most significant damage. In addition, diseases caused mainly by the Ralstonia solanacearum complex lack adequate control solutions. Despite everything, today, very few studies are carried out to identify these bacteria in order to prevent their spread in the soil in Mali. This is why the objective of this study is to identify the bacteria responsible for brown rot in potato seeds in Mali. To achieve our objective, a total of 63 samples were taken from nine varieties of imported and locally multiplied potato seeds. The agent responsible for brown rot was isolated on the Triphenyl-Tetrazolium-chloride culture medium, and several microbiological, biochemical and molecular tests were carried out to identify the different isolates selected. As the main results of this study: twenty-seven bacterial isolates, capable of causing brown rot of potato seeds were isolated, the biochemical tests carried out on these isolates showed that they all of race3 and twenty -four isolates were biovar 3; one from biovar 2 and two from biovar 6. The molecular studies carried out using universal primers confirmed the presence of the species Ralstonia solanacearum with two phylotypes (I and II).

Published in International Journal of Microbiology and Biotechnology (Volume 9, Issue 3)
DOI 10.11648/j.ijmb.20240903.11
Page(s) 43-53
Creative Commons

This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.

Copyright

Copyright © The Author(s), 2024. Published by Science Publishing Group
Previous article
Keywords

Seeds, Potato, Brown Rot, Ralstonia Solanacearum, PCR

1. Introduction
The potato (Solanum tuberosum) is an annual plant of the Solanaceae family
[1]
. It is the main non-cereal food in the world, after corn, wheat, and rice with a global production of 437 million tons on an area of 20.7 million hectares
[1]
. This culture has developed well in Asia unlike Africa. Speculation gains popularity every year on the African continent. From 2006 to 2018, production increased because of its nutritional importance, employment and source of income
[1, 2]
.
Mali was the second producer in West Africa after Nigeria and first in French-speaking Africa with an average production of 250,000t to 310,000 tons during the 2019 agricultural campaign
[3]
. Sikasso, the third region of Mali, represents the potato growing area par excellence in Mali and represents the largest production basin. It produces three quarters of national production, or 80%
[4]
. The potato has been classified as a strategic crop in Mali
[5]
. From the introduction of the crop in Mali, all seeds were imported until 2018, i.e. 9,000 to 11,000 tons per year. The local multiplication of Elite (E) seeds in class A was implemented from the 2017-2018 agricultural campaign until the present day (2022-2023) by the Potato and Potato Sector Support Program and Milk (PAFA 1) in the Sikasso region in synergy with the Green Innovation Center (CIV/AFC/GIZ). From 2018 to 2023, around 5% of seeds were multiplied locally.
Unfortunately, in recent decades, potato production in Mali has been confronted with several attacks of pathologies, particularly bacteria
[6]
, causing significant economic damage among which, that responsible for the brown rot Ralstonia solanacearum, the most devastating in the world according to
[7]
. It causes considerable losses of around 50% to 100% on potatoes.
[7, 8]
. These different pathogens are represented by quarantine bacteria (those responsible for ring rot and brown rot) and quality bacteria (those causing soft rot and common scab diseases). Seeds and soils are the main factors in transmitting the pathogen. Dissemination is favored by water irrigation and work tools
[9]
. Generally speaking, the pathogen spreads from the mother tuber to the child tubers, up to the stem
[10]
. For this, strict monitoring of the agent responsible for the disease has been put in place in the nightshade production areas, particularly those of potato seeds throughout the world. In particular, measures to prevent its introduction from one territory to another. It has been classified as a dangerous organism in all continents of the world. It is an organism with obligatory control in many countries where its presence has been declared such as in Mali and quarantine in continents where it is not present in the OPPE.
In Mali, very few studies have been carried out on potato pathogens in general and the bacteria responsible for brown rot in particular.
It has been declared a compulsory control organism in many countries, such as Mali. Hence this study on the characterization and evaluation of the diversity of the agent responsible for brown rot in potato seeds imported and produced in Mali.
2. Material and Methods
2.1. Biological Material
Twenty tubers from nine potato varieties (Claustar, Evora, El Beïda, Liseta, Mondial, Sahel, Sagitta, Sifra and Spunta) were collected randomly from four local potato seed multipliers and three seed importing companies in the Sikasso and Ségou regions.
2.2. Microbiological Characterization
2.2.1. Sample Preparation and Seeding
Different analyzes were carried out on the sixty tubers taken randomly from boxes of 25 kg of potato seeds. From each case, samples were taken three times. The tubers were washed well with tap water to remove all impurities from the outside of the samples without damaging the seed coat. They were dried at room temperature on sterilized blotting papers. The tubers, previously cleaned, were weighed. Two hundred and fifty grams of tubers from each dried sample were weighed. They were disinfected using chloramine T (2%) and ethanol (70%) for three minutes then rinsed with sterile distilled water. The samples were then cut into two parts on aluminum foil with a clean knife (well disinfected with 96% ethanol) and flambéed under the hood. The tubers were cut into small pieces and inoculated on the Triphenyltetrazolium Chloride (TZC) medium used to distinguish R. solanacearum among other bacteria, then incubated at 28°C
[11]
.
2.2.2. Macroscopic Characterization
After incubation, colonies with the typical characteristics of the bacteria responsible for brown rot were selected and purified. Selection criteria were based on shape, color, consistency, contour, size and odor.
2.2.3. Microscopic Characterization
(i). Gram Stain
Its objective is to be able to make a preliminary selection of purified isolates based on their coloring: gram positive or negative. It was carried out using smears of colonies of different bacterial isolates on a microscopic slide. After carrying out the gram staining technique, a microscopic observation was made to have the shape and color of bacteria present in the colony.
Gram staining makes it possible to differentiate between bacteria according to the properties of the wall. Gram-positive bacteria stain purple, Gram-negative bacteria pink
[12]
.
(ii). Mobility Test
This test was carried out on the bacterial isolates after 24 hours of incubation at 28°C. A little quantity of each bacterial culture was taken using a sterile Pasteur pipette and placed on a slide covered with a coverslip. The slide thus prepared was directly observed under an optical microscope at 40x magnification
[12]
.
2.3. Biochemical Characterization
The biochemical tests were based on the production of oxidase, catalase, KOH and of fulminous pigments.
2.3.1. Oxidase and Catalase Production Test
The oxidase test consisted of Place 2 to 3 drops of a 1% solution of tetra-methyl-p-phenyl diamine dihydrochloride directly onto a young colony of bacteria on a clean slide. The appearance of a purple color within 1 minute indicated the presence of an oxidase-positive bacteria (oxidase +).
To carry out the catalase test, the different isolates were placed directly on a slide. Then, using the Pasteur pipette, a drop of hydrogen peroxide (H2O2) was placed on the bacterial culture. The formation of bubbles corresponds to the production of catalase, therefore to a catalase-positive bacteria (catalase +),
[12]
.
2.3.2. KOH 3% Test
A drop of 3% KOH was placed on a clean glass microscopic slide. Then, a colony of each typical bacteria was emulsified into the drop using a toothpick for 5–10 seconds. The formation of a viscous filament (Agglutination) when lifting the toothpick is referred to as Gram negative (KOH positive).
On the other hand, in the absence of filament, the Gram will be considered positive (KOH negative)
[12]
.
2.3.3. Fluorescent Pigment Production Test
The selected isolates, cultured on King B medium in Petri dishes, then incubated for 48 hours at 30°C, were illuminated with an ultraviolet ray lamp, in a dark enclosure. The petri dish exhibiting bright luminosity in the dark is fluorescent
[13]
.
2.3.4. Pot Pathogenicity Test on Potato Plants
It makes it possible to identify among the isolates tested those which can cause wilting of plants. The variety used was Naïma, resulting from local propagation. Its growing cycle is 80 days. Young bacterial colonies aged up to 48 hours were inoculated in bottles containing 100ml of Kelman's liquid agar medium, without Tetrazolium. The bacterial solutions were stirred for 48 hours. Infiltration was carried out using a sterile syringe with three repetitions per isolate. The roots were wounded before deliberately inoculating them with a disinfected knife to allow direct contact between the inoculum and the sap-conducting vessels. A total of 78 plants aged 30 days maximum were inoculated with the 27 bacterial isolates and the liquid medium without inoculum was used as a control. The plants were stressed at least 16 hours before and 24 hours after inoculation during the cool period.
[14]
. Observations were conducted 72 hours up to 30 days after inoculation. They were carried out on the number of withered plants (figure 2).
2.3.5. Identification of Biovars
The technique which makes it possible to distinguish the different biovars of Ralstonia solanacearum within the different isolates was based on biochemical tests relating to the abilities of the isolates to use and/or to oxidize three disaccharides, in particular maltose, lactose and cellobiose as well as three hexose alcohols mannitol, sorbitol and dulcitol (table 1),
[15, 16]
.
The basic medium used for this purpose consists of this 1.0 g Bacto-peptone, 1.0 g NH4H2PO4, 0.2 g KCl, 0.2 g MgSO4, 7H2O, 0.03 g Bromothymol Blue, 3. 0 g of Agar in a liter of distilled water 1,000 ml
[15-17]
.
The tubes containing the different sugars were inoculated by taking colonies of pure isolates using sterile toothpicks. Each of the seeded isolates was replicated three times per sugar and per alcohol. The tubes were incubated at 28°C and examined at 48 h and 72 h. A color change from olive green to yellow indicating a change in acidic pH, the test result would be positive,
[18, 19].
For sugar alcohols, the reaction took place between 3 and 5 days and a little longer for disaccharides. The type of Biovar was determined according to its ability to oxidize each substrate (Table 1).
Table 1. Biovar determination of Ralstonia solanacearum isolates based on acid production through the use of various carbohydrates.

Substrates

Biovars

1

2

3

4

5

6

3b

Cellobiose

-

+

+

-

+

+

+

Maltose

-

+

+

-

+

+

+

Lactose

-

+

+

-

+

+

-

Dulcitol

-

-

+

+

-

-

-

Sorbitol

-

-

+

+

-

+

+

Mannitol

-

-

+

+

+

+

+
+: Use of the substrate; -: Substrate not used
PLOS UN |https://doi.org/10.1371/journal.pone.0274780 September 22, 2022 3 / 36
[20]
2.3.6. Determination of Breeds by Tobacco Hypersensitivity Test
The tobacco hypersensitivity test was developed by
[21]
and used to distinguish between races 1, 2 and 3 of the species Ralstonia solanacearum. A density of a bacterial suspension of approximately 108 CFU/ml, aged (24 to 48 hours) was injected between the epidermis and the palisade parenchyma of young tobacco leaves aged 22 days. Infiltration of the isolates was done using a needleless syringe, by carefully pressing the tip of the syringe on the lower part of the leaves. Observations were made 24,48,72 and 192 hours after infiltration according to the scheme of
[21]
. The test was considered positive if a necrotic area corresponding to the infiltrated area appeared after 7-8 days, indicating race 1. Isolates showing a reaction between 12 -24 hours, indicating race 2 and race 3 a been indicated by a reaction between 2-8 days. The test is negative if no reaction is observed.
2.4. Molecular Characterization
2.4.1. DNA Extraction
A sample of young bacterial colonies aged 24 hours was placed in 1.5ml Eppendorf tubes containing 500ul of NaCL. The mixtures were centrifuged for 2 min at a speed of 10,000 rpm and then the supernatants were discarded. Seven hundred and fifty microliters (750 μl) of Cetyltrimethylammonium Bromide (TAB 3%) buffer solution were added to the pellet. The new mixture was incubated in a water bath for 30 minutes at 65°C then 400 μl of chloroform was added and centrifuged for 10 minutes at 10,000 rpm. The supernatants were transferred to a new tube containing 1 ml of 100% ethanol, then cooled on ice for 10 min for DNA precipitation. After centrifugation for 5 minutes, the pellet was collected then washed with 500 μl of 70% ethanol. The whole was centrifuged for 1 min. The samples were dried at room temperature for 1 hour. Then 150 μl of Nuclease Free water was added to the DNA pellets and vortexed to dissolve the pellet in order to obtain a homogeneous DNA suspension for carrying out the PCR. The DNA suspensions of the samples were stored at 4°C overnight.
2.4.2. Bacterial DNA Amplification
The DNAs were amplified with four pairs of primers specific to the different phylotypes of the species Ralstonia solanacearum. The primer names and sequences are listed in the table below.
Table 2. Specific primers used in multiplex PCR to identify the species Ralstonia solanacearum and the Phylotypes belonging to it.

Primer names

Sequences 5'-3'

Amplified fragment size

Phylotypes

Nmult

21:1F

CGTTGATGAGGCGCGCAATTT

144 bp

I (Asiaticum)

Nmult

21:2F

AAGTTATGGACGGTGGAAGTC

372 bp

II (Americanum)

Nmult

23:AF

ATTACSAGAGCAATCGAAAGATT

91 bp

III (African)

Nmult

22:InF

ATTGCCAAGACGAGAGAAGTA

213pb

IV (Tropical)

Nmult

22:RR

TCGCTTGACCCTATAACGAGTA

Reverse primer

Any phylotype

759

R

GTCGCCGTCAGCAATGCGGAATCG

280 bp (Internal marker)

Ralstonia

760

F

GTCGCCGTCAGCAATGCGGAATCG
(Source: FEGAN and PRIOR, 2005)
A total reaction volume of 15 µl was formed for each DNA sample in the PCR tubes (trips of 8 PCR Tubes), consisting of 7.5 µl Go Taq G2 Hot Start Green Master Mix 2X (Promema), 1 µl (100pmol /µl) of the forward primer, 1 µl (100pmol/µl) of the reverse primer, 2µl (20ng/µl) of the DNA suspension and 3.5 µl of Nuclease-Free Water. Amplification was carried out using the 2720 applied System thermal cycler programmed as follows: initial denaturation: 94°C for 5 mins, denaturation: 94° for 1 min, hybridization: 55°C for 45 seconds, elongation: 72°C for 1 min 30, final elongation: 72°C for 10 minutes and conservation of the DNA: 4°C forever in order to multiply the target sequence(s) in large quantities. The denaturation, hybridization and elongation steps are repeated 35 times. The PCR was carried out in two phases; The first was the identification of the species using Oligo nucleotide primers 759R/760F according to the conventional protocol of
[22]
, markers internal to the ceRs, for the diagnosis of Ralstonia solanacearum molecule. The second phase was based on the identification of the phylotype using multiplex PCR.
2.4.3. Electrophoresis and Visualization of PCR Products
6µl of the PCR product were loaded and migrated on a D1LOW EEO 1.5% (weight/volume) agarose gel which is recommended for the separation of DNA fragments. The migration was carried out for 1 h at 90V. After migration, the gel was prepared with 0.5X TBE buffer solution (Tris-acetic acid-EDTA). 30µl of 10% ethidium bromide, visualized, the gel was photographed under UV using the Gel DOC device. The size of the bands is estimated by comparison with the bands of the 100 bp molecular weight marker (Ladder).
2.5. Data Analysis
The size of the fragments (bands) obtained was determined using the ECap software. The presence of the 280 bp fragment, amplified by specific primer pair 759R/760F, indicates the presence of the species Ralstonia solanacearum. For the identification of phylotypes by multiplex PCR, the 144 bp fragment indicates the presence of phylotype I (Asiaticum), 372 bp indicates the presence of phylotype II (Americanum), 91 bp indicates the presence of phylotype III (African) and 213 bp indicates the presence of phylotype IV (Tropical)
[22-24]
.
3. Results
3.1. Microbiological Characteristics
3.1.1. Colonies Isolated from Samples Collected
Thirty-one isolate withs characteristic colonies of the species Ralstonia solanacearum were retained and purified. Among them, seven were isolated from five imported potato varieties and fourteen from three locally produced varieties. The distribution of the isolates obtained according to origin and host varieties is recorded in Table 3.
Table 3. Distribution of isolates according to origin and host varieties.

Source of seeds

Potato host varieties

Name of isolates

Total number

Imported

Claustar

RIC1

13

Mondial

RIM1, RIM2

Liseta

RIL1, RIL2

Sagitta

RISa1, RISa2

Sifra

RISi1

Spunta

RISp1

Evora

RIE1, RIE2

El Beida

RIEL1, RIEL2

Local

Sahel

RLSh1

18

Claustar

RLC1, RLC2, RC3, RLC4, RLC5, RLC6, RLC7, RLC8, RLC9, RLC10

Spunta

RLSp1, RLSp2, RLSp3, RLSp4 RLSp5, RLSp6 RLSp7

Total

31
R.L.: Ralstonia from local production seed; RI: Ralstonia from imported seed; C-Claustar; Sp-Spunta; Si-Sifra; Sa-Sagita; El-Elbeïda; E-Evora; Sh-Sahel; M-World
3.1.2. Macroscopic Characters
Ofs mucous, pinkish-red and elliptical colonies, characteristic of the species Ralstonia solanacearum, were retained and purified (figure 1).
Figure 1. Macroscopic appearance of some isolates on TZC solid media.
3.2. Microscopic and Biochemical Characters
Among the thirty-one isolates, twenty-seven were characteristic of Ralstonia solanacearum by presenting themselves as Gram negative bacilli, KOH 3% positive andmobile thanks to their flagellum. The four other non-characteristic Ralstonia isolates were excluded from the list.
All isolates were positive for catalase and negative for fluorescent pigment production. Thirteen and fourteen isolates were positive and negative for catalase and oxidase, respectively. The KOH, catalase and Oxidase positive, Gram and pigment production negative isolates are characteristic of the species and were retained for further identification. The test results are reported in Table 4.
Table 4. Microscopic and biochemical characteristics of the isolates according to the tests.

Isolates tested

Testing

KOH

Gram

Catalase

Oxidase

Fluorescent pigment production

RISa1; RIE1; RIM1; RIEL1; RLSh1; RLSp1; RLSp2; RLSp3; RLSp4; RLC3; RLC6; RLC7; RLC8; RLC9; RLC10; RLSp7

+

-

+

+

-

RISi1; RISp1; RIE2; RISa2; RIEL2; RLC1; RLC2; RLC4; RLC5; RLSp5; RLSp6

+

-

+

-

-
R.L.: Ralstonia from locally produced seeds; RI: Ralstonia from imported seeds.
3.2.1. Pathogenicity of Isolates Retained on Potato Plants
After thirty days of observations, twenty-one isolates caused wilting on six-week-old potato plants of the “Naïma” variety (figure 2). The RLC4 and RLC6 isolates were more pathogenic showing symptoms from the first week after inoculation. The isolatesRIE2; RIM1; RLC3; RLC9; RLSp6 did not cause wilting on plants and was considered nonpathogenic (Table 5).
Table 5. Reaction of bacterial isolates tested on potato plants in pots showing the number of plants infiltrated by the isolates and dead plants.

Isolates tested

Number of plants infiltrated per isolate

Number of wilted plants per infiltrated isolate

RISa1; RISi1; RISa2; RISp1; RIE1; RIEL1; RIEL2; RLSh1, RLC1; RLC2; RLC4; RLC5; RLC6; RLC7; RLC8; RLC10; RLSp1; RLSp2; RLSp3; RLSp4; RLSp5; RLSp7

3

3

RIE2; RIM1; RLC3; RLC9; RLSp6

3

0
R.L.: Ralstonia from Local seed; RI: Ralstonia from imported seed; C-Claustar; Sp-Spunta; Si-Sifra; Sa-Sagita; El-Elbeïda; E-Evora; Sh-Sahel; M-World
Figure 2. Potato plants of the Naïma variety after inoculation with bacterial isolates. A: Overview of wilted plants 15 days after planting without infiltration, LaboSem-Sotuba, 2020; B: Wilting of plants of the Naïma variety 9 days after inoculation with the bacterial isolate RIEL2, LaboSem-Sotuba, 2020; C: Wilting of plants of the Naïma variety 22 days after inoculation with the bacterial isolate RLSp7 LaboSem-Sotuba, 2020.
3.2.2. Biovars
The test for the degradation of disaccharides and hexose alcohols was carried out on the twenty-seven isolates, the results are recorded in Table 6.
Table 6. Distribution of isolates according to biovars after the test on disaccharides and hexose alcohols.

Isolates tested

Disaccharides

Hexose alcohols

Biovars

Cellobiose

Lactose

Maltose

Mannitol

Dulcitol

Sorbitol

RLC6

+

+

+

-

-

-

2

RISa1; RISi1; RISp1; RIE1; RIE2; RISa2; RIEL1; RIEL2; RLSh1; RLSp1; RLSp2; RLC1; RLSp3; RLSp4; RLC2; RLC3; RLC4; RLC5; RLC7; RLSp5; RLSp6; RLC8; RLC9; RLSp7

+

+

+

+

+

+

3

RIM1; RLC10

+

+

+

+

-

+

6
RL: Ralstonia from Local seed; RI: Ralstonia from imported seed
3.2.3. Breed of Isolates
The results of testing the tobacco isolates showed that all isolates are race 3.
3.3. Molecular Characters
PCR to identify the species and its phylotypes showed that the isolates are of the species Ralstonia solanacearum divided into two phylotypes I and II (Table 7, Figure 3).
Table 7. Distribution of isolates according to phylotypes obtained by PCR.

Isolates

Phylotypes

RLSp6; RLC9

I

RISa1; RISi1; RISp1; RIE1; RIE2; RIM1; RISa2; RIEL1; RIEL2; RLSh1; RLSp1; RLSp2; RLC1; RLSp3; RLSp4; RLC2; RLC3; RLC4; RLC5; RLC6; RLC7; RLSp5; RLC8; RLC10; RLSp7

II
Figure 3. Migration profiles of Ralstonia solanacearum isolates amplified with the multiplex primers Nmult:21:1F (phylotype I), Nmult:21:2F (phylotype II), Nmult:23:AF (phylotype III), Nmult:22: InF (phylotype IV); Nmult:22:RR on AgaroseD1LOW EEO at 1.5%, migrated to 90V for 1 hour. After migration, the gel was photographed under UV using the Gel Doc device. RLSp6, RLC9 (phylotype I); RISa1; RISi1; RISp1; RIE1; RIE2;; RISa2; RIEL1; RIEL2; RLSp1; RLSp2; RLC1; RLSp3; RLSp4; RLC2; RLC3; RLC4; RLC5; RLC7; RLSp5; RLC8; RLSp7; RLC6; RIM1; RLC10 (phylotype II).
4. Discussion
Microbiological and biochemical tests made it possible to identify twenty-seven isolates of Ralstonia solanacearum in potato seed samples imported and locally produced in Mali from the 2017-2018 agricultural season. The number of isolated and purified bacterial isolates was higher with locally produced Claustar and Spunta varieties than imported ones. These results confirm those
[25, 26]
who reported the presence of Ralstonia strains on infected plants, potato tubers and other nightshades in Niger and Mali respectively. Furthermore,
[27]
identified eight Ralstonia solanacearum in samples of potato tubers collected from four districts of the Vakinankaratra region in Madagascar on Cassamino acid peptone glucose (CPG) culture medium. But first,
[28]
identified 24 strains of Ralstonia solanacearum during the integrated control of bacteriosis caused by the species on potatoes in small farms in the Vakinankaratra Region. Our results revealed that of the 27 Ralstonia solanacearum isolates identified, 40.74% were oxidase positive and 100% catalase positive. These results were different from those obtained by
[29]
who found 87% of his isolates catalase positive and 81% oxidase positive. These strains were isolated from infected tomato plants and soil in the Baguinéda Irrigated Perimeter Office area in Mali. They agree with those of
[27]
of which out of eight isolates identified as Ralstonia solanacearum, 38% were positive for catalase and oxidase in four districts of the Vakinankaratra region.
The pathogenicity test of our strains on potato plants in pots showed great variability within the species with a variable degree of virulence between the strains. Strains RLC4 and RLC6 showed virulence by causing the death of plants after 7 days of inoculation. The RIEL1, RIEL2 and RLSp7 strains caused the death of the plants after 15 days of inoculation. On the other hand, 81.48% of the strains caused the death of the inoculated plants after 30 days of observation. These results allow us to explain that there is variability in virulence within the species Ralstonia solanacearum.
[25]
obtained 42.31% of its pathogenic strains on inoculated potato and tomato plants. From the first, the second week and the fourth week, variability was observed at the level of 80.77% of the strains causing the death of the inoculated plants. The same observation was made by
[25]
from the fourteenth, sixteenth and eighteenth day of observation. This author confirms the variability of the pathogenic power of the species Ralstonia solanacearum from samples of imported or locally produced potato seeds.
Three biovars were identified in this study: biovar 2, 3 and 6. The most dominant was biovar 3 with 88.5%, followed by biovar 6 with 7.7%. These results are different from those obtained by
[26-29]
who obtained only biovar 3.
[25]
obtained biovar 2 and 3 with a dominance of biovar 2 on potato plants and tubers grown from seeds imported from Europe. He had also identified two variables within biovar 2 (biovar 2 biotype 2A and biovar 2 biotype 2T). Biovar 2 biotypes 2A was the most dominant at 59.1%. Similarly,
[27]
obtained two biovars isolated from potato tubers in the four districts of the Vakinankarata region of Madagascar. Biovar 2 was also the most dominant with 25%.
[30]
had isolated and identified thirty-six strains of Ralstonia solanacearum on nightshade plants (eggplant, tomato, chilly, pepper) and other families (gourd and marigold) in five agro-climatic zones in India. The authors identified two biovars, biovar 3 and 6 with a dominance of biovar 3. These results are in line with ours where biovar 3 was the most dominant.
The leaves of tobacco plants aged twenty-one days after transplanting were inoculated with twenty-seven strains of Ralstonia solanacearum in the pots. Dark brown lesions, surrounded by a yellow halo, were observed after 24 hours of infiltration and developed from 48 hours to 72 hours, up to a week without the plants being wilted: this is race 3 Our results agree with those of
[29]
who also obtained race 3 using the same method. On the other hand, they are different from those of
[26]
who had obtained race 1. This race 1 is known for its broad spectrum of hosts including nightshades, notably potatoes and other weed plants. It is called the “African” race,
[24-32]
. Race 3 has been described as the pathogen of potato and tomato. It is specific to temperate zones and more widespread on the five continents
[24-33]
. Only race 1 was identified by
[30]
on nightshade plants (eggplant, tomato, chili, pepper) and other families (gourd and marigold). Our results agree with those of
[34]
. They were able to identify race 1 and race 3 in soil samples collected from thirty-four sites in seven major tomato bacterial wilt endemic areas in Nigeria. Race 1 was more dominant with 88.24% of strains.
5. Conclusion
The twenty-seven isolates were confirmed as Ralstonia solanacearum (ceRs.) strains by PCR with the use of the specific primer 759R/760F. Multiplex PCR confirmed the presence of phylotypes I and II in this study. According to them, Phylotype I has a wider host range than the other three
[35-37]
.
[30]
had 100% of its strains isolated as Phylotype I. Our results are in line with those
[25]
who obtained three phylotypes (I, II and III) with a dominance of phylotype II (61.54%).
The microscopic, biochemical and molecular characterization of the thirty-one isolates made it possible to select and isolate twenty-seven bacterial isolates of Ralstonia solanacearum strains from imported and locally produced potato seeds.
Strains were characterized as Ralstonia solanacearum, with diversity within the species. Two biovars and two phylotypes were identified within the diversity.
Abbreviations

PCR

Polymerization Chain Reaction

UV

Ultraviolet

Pb

Pair of Bands

Labosem-Sotuba

Plant Seed Certification Laboratory
Acknowledgments
My sincere thanks to the Faculty of Science and Technology (FST), the staff of LaboREM-Biotech and the Institute of Rural Economy (IER) who spared no effort in carrying out this work.
Conflicts of Interest
The author declares no conflicts of interest.
References
[1] COAG/2022/19. Proposal relating to the proclamation of an International Potato Day.
[2] FaoStat. (2018). Prospective analysis bulletin of the agricultural market. SOS potato sector. Crops and animal products. 12 p.
[3] Inter-professional Potato Group. 2019. newsletter N°2, rap pdt, 2017; bio online, 2019.
[4] Bruno Vanderhofstad (2019). Information and status report on the production of seed potatoes in Mali. Return of information to the Sikasso workshop.
[5] Potato Mali Interprofessional Association. (2021). National strategy for the development of the potato sector in Mali. Produce 1 million tonnes by 2026. Article by Brehima Diallo.

www.maliweb.net

[6] Moussa BOIRE and Lassana B. TRAORE. (2018). Identification of Erwinia responsible for soft rot of potatoes sold on the Medina Coura market. (Bamako). 1. P. 9.
[7] Rakotoniaina Andry Mampionona. (2022). Exploitation of soil Actinomycetes for the biocontrol of potato bacteriosis caused by Ralstonia solanacearum. 83 p.
[8] FaoStat. (2020). Report of the Committee on Agriculture, twenty-eighth sessions. Proposal relating to the proclamation of an international potato day.
[9] Florent AILLOUD. (2015). Pathogenicity in Ralstonia solanacearum phylotype II integrative genomics and transcriptomic landscapes in relation to host adaptation. Thesis: UNIVERSITY OF RÉUNION Faculty of Sciences and Technologies Doctoral School of Sciences, Technologies and Health. 11. P (223).
[10] Salgon, S. (2017). Genetic determinism of resistance to bacterial wilt in eggplant and applications in varietal selection (Doctoral dissertation, University of Reunion).
[11] Kelman A. 1954. The relationship of pathogenicity in Pseudomonas solanacearum to colony appearance on a tetrazolium medium. Phytopathology 44: 693–695.
[12] Kassogué et al (2015). Isolation and characterization of Bacillus thuringiensis (Ernst Berliner) strains indigenous to agricultural soils of Mali, pages n°6. 9 p.
[13] Zubeda, C. and Hamid, R. (2011). Isolation and characterization of Ralstonia solanacearum from infected tomato plants of Soan Skesar valley of Punjab. Pak. J. Bot. 7(2). P. 2980.
[14] RR Bhanwar, PK Tiwari, RK Dantre, RR Saxena, A. Tiwari and A. Kotasthane. (2021). Determination of Races and Biovars of Ralstonia solanacearum causing Bacterial Wilt of Brinjal in Chhattisgarh, India, International Journal of Current Microbiology and Applied Sciences. ISSN: 2319-7706 Volume 10 Number 06. (2021). 5-6. 12P.
[15] Hayward, A. C., (1964). Characteristics of Pseudomonas solanacearum. J Appl Microbiol. 27(2): 265-277.
[16] HaywardAC, El-Nashaar HM, Nydegger U. and DE Lindo L. 1990. Variation in nitrate metabolism in biovars of Pseudomonas solanacearum. Journal of Applied Bacteriology, Vol. 69, p. 269-280.
[17] Hayward AC, 1976. Systematics and relationship of Pseudomonas solanacearum, p. 6-21. In: Proceedings of the 1st International Conference and Workshop on the Ecology and Control of Bacterial Wilt Caused by Pseudomonas solanacearum. L. Sequeira and A. Kelman (Editors), North Carolina State University, Raleigh, NC.
[18] Martin, Prior, P., Cadet, P., & Steva, H. (1989). Variability of the pathogenic power of Pseudomonas solanacearum in the French West Indies (Martinique and Guadeloupe). Acta Oecol, 10, 135-142.
[19] Schaad NW, Jones JB, Chun W. (2001). Laboratory guide for the identification of plant pathogenic bacteria. 3rd ed. APS Press, St. Paul, USA. p 373.
[20] PLOS UN

https://doi.org/10.1371/journal.pone.0274780 September 22, 2022 3 / 36.

[21] Lozano, J. and Sequeira, L. (1970). Differentiation of Ralstonia solanacearum races using a foliar infiltration technique. Phytopathol. 60. P. 833-838.
[22] Fegan and Prior. (2005). Ralstonia solanacearum species complex”. In Allen Bacterial wilt disease and the Ralstonia solanacearum species.
[23] Opina N., F. Tavner, G. Hollway, J.-F. Wang, T.-H. Li, R. Maghirang, M. Fegan, AC Hayward, V. Krishnapillai, WF Hong, BW Holloway, and J. Timmis. (1997). A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia Pac. J. Mol. Biol. Biotechnology. 5: 19–30.
[24] Ravelomanantsoa Santatra Herilalaina, (2016). Population biology of the Ralstonia solanacearum species complex applied to the epidemiology of bacterial wilt of potatoes in Madagascar. PhD. University of Antananarivo. Doctoral School of Life and Environmental Sciences. Biotechnology specialty. Antananarivo. Madagascar. 27-28. P (239).
[25] Adamou (2011), Characterization of local strains of Ralstonia solanacearum (EF SMITH) YABUUCHI et al. and evaluation of the behavior of six varieties of potato (Solanum tuberosum L.) against strain RS-09-76, in Niger. Doctoral thesis. University of Ouagadougou. P (76-89), 197P.
[26] Aïssa Thera (2007), Bacterial wilt management: a prerequisite for a potato seed certification program in Mali, Master of Science Thesis. Montana State University. USA. P (94-97). 142P.
[27] Rakotoniaina Andry M. (2022). Epidemiological study of bacterial wilt of potatoes in the Vakinankaratra region of Madagascar. P (26-30). 83P.
[28] Parrur. (2013). Integrated control of bacterial wiltof bacteriosis (Ralstonia solanacearum) of potatoes in small farms. through the control of the phytosanitary state of potato seed tubers and the detection of populations of Ralstonia solanacearum in the soil of the Vakinankaratra Region. 13-15. P (40).
[29] Magnan Diarraand hasl (2019). Search for microorganisms capable of controlling strains of Ralstonia solanacearumisolated and characterized in the Baguinéda Irrigated Perimeter Office. article of.
[30] Ankit Kumar Ghorai, Subrata Dutta. Ashis Roy BarmanID (2022). Genetic diversity of Ralstonia solanacearum causing vascular bacterial wilt under different agro-climatic regions of West Bengal, India, 8-9; 36p.
[31] Hayward, A. (1991). Biology and epidemiology of bacterial wilt caused by Pseudomonas solanacearum. Anne. everend Phytopathol. 29. P. 65-87.
[32] Leroux AC. (1996). Study of the resistance of potato varieties and genotypes to Ralstonia solanacearum, In: Production of serological reagents for the detection of Ralstonia solanacearum. INRA-FNPPPT activity report. p. 27-31.
[33] Wilfried Kayaba Ouédraogo. (2016). Characterization of isolates of Ralstonia solanacearum (EFSMITH), Yabuuchi et al, causal agent of bacterial wilt in the market gardening areas of Houet, Kenedougou and Passore and Search for varieties resistant to the disease in Burkina Faso, End of cycle dissertation, Institute Polytechnique de Bobo-Dioulasso, 9-10, P. 66.
[34] Popoola, Arizona, Ganiyu, SA, Enikuomehin, OA, Bodunde, JG, Adedibu, O B., Durosomo, HA and Karunwi, OA. (2015). Isolation and characterization of Ralstonia solanacearum Causing bacterial wilt of tomato in Nigeria. 6-7. P. 10.
[35] Castillo, JA and Greenberg, JT (2007). Evolutionary dynamics of Ralstonia solanacearum. Appl. Approximately. Microbiol. 73. 1225–1238.
[36] Wicker E, Lefeuvre P, de Cambiaire JC, Lemaire C, Poussier S, Prior P. (2012). Contrasting recombination patterns and demographic histories of the plant pathogen Ralstonia solanacearum inferred from MLSA. ISME Magazine. 6(5): 961-974 from

https://doi.org/10.1038/ismej.2011.160 PM ID: 22094345.

[37] Hasina Ny Aina Rasoamanana. (2022). Population biology of the Ralstonia solanacearum species complex in Madagascar and the southwest Indian Ocean. Thesis. Hal. Science. 45(32). P (242).
Cite This Article
Plain Text BibTeX RIS

  • APA Style

    Diallo, B., Kassogué, A., Fané, R., Coulibaly, M., Dao, S., et al. (2024). Diversity of the Ralstonia Solanacearum Species of Potato Seeds in Mali. International Journal of Microbiology and Biotechnology, 9(3), 43-53. https://doi.org/10.11648/j.ijmb.20240903.11

    Copy | Download

    ACS Style

    Diallo, B.; Kassogué, A.; Fané, R.; Coulibaly, M.; Dao, S., et al. Diversity of the Ralstonia Solanacearum Species of Potato Seeds in Mali. Int. J. Microbiol. Biotechnol. 2024, 9(3), 43-53. doi: 10.11648/j.ijmb.20240903.11

    Copy | Download

    AMA Style

    Diallo B, Kassogué A, Fané R, Coulibaly M, Dao S, et al. Diversity of the Ralstonia Solanacearum Species of Potato Seeds in Mali. Int J Microbiol Biotechnol. 2024;9(3):43-53. doi: 10.11648/j.ijmb.20240903.11

    Copy | Download 

  • @article{10.11648/j.ijmb.20240903.11,
  author = {Binta Diallo and Adounigna Kassogué and Rokiatou Fané and Moctar Coulibaly and Sognan Dao and Ibrahima Mallé and Amadou Hamadoun Babana},
  title = {Diversity of the Ralstonia Solanacearum Species of Potato Seeds in Mali
},
  journal = {International Journal of Microbiology and Biotechnology},
  volume = {9},
  number = {3},
  pages = {43-53},
  doi = {10.11648/j.ijmb.20240903.11},
  url = {https://doi.org/10.11648/j.ijmb.20240903.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ijmb.20240903.11},
  abstract = {Potato brown rot was classified as a quarantine disease because of the complexity of the pathogen Ralstonia solanacearum L., formerly called Pseudonomas or Burkholderia solanacearum. This same bacterium causes the disease bacterial wilt. It is a multifaceted bacterium hence the complex name Ralstonia solanacearum (CeRs or RASLSSO) or BW (in English). It attacks several plant families, notably nightshades such as potatoes; the tomato; eggplant; chili pepper; tobacco…etc. The potato is the most cultivated plant worldwide. Mali is the second largest producer in West Africa after Nigeria. It imports more than 9,000 to 11,000 tons of seeds each year. Potato cultivation is faced with several biotic and abiotic attacks. Among all these attacks, those caused by bacteria cause the most significant damage. In addition, diseases caused mainly by the Ralstonia solanacearum complex lack adequate control solutions. Despite everything, today, very few studies are carried out to identify these bacteria in order to prevent their spread in the soil in Mali. This is why the objective of this study is to identify the bacteria responsible for brown rot in potato seeds in Mali. To achieve our objective, a total of 63 samples were taken from nine varieties of imported and locally multiplied potato seeds. The agent responsible for brown rot was isolated on the Triphenyl-Tetrazolium-chloride culture medium, and several microbiological, biochemical and molecular tests were carried out to identify the different isolates selected. As the main results of this study: twenty-seven bacterial isolates, capable of causing brown rot of potato seeds were isolated, the biochemical tests carried out on these isolates showed that they all of race3 and twenty -four isolates were biovar 3; one from biovar 2 and two from biovar 6. The molecular studies carried out using universal primers confirmed the presence of the species Ralstonia solanacearum with two phylotypes (I and II).
},
 year = {2024}
}

    Copy | Download 

  • TY  - JOUR
T1  - Diversity of the Ralstonia Solanacearum Species of Potato Seeds in Mali

AU  - Binta Diallo
AU  - Adounigna Kassogué
AU  - Rokiatou Fané
AU  - Moctar Coulibaly
AU  - Sognan Dao
AU  - Ibrahima Mallé
AU  - Amadou Hamadoun Babana
Y1  - 2024/07/08
PY  - 2024
N1  - https://doi.org/10.11648/j.ijmb.20240903.11
DO  - 10.11648/j.ijmb.20240903.11
T2  - International Journal of Microbiology and Biotechnology
JF  - International Journal of Microbiology and Biotechnology
JO  - International Journal of Microbiology and Biotechnology
SP  - 43
EP  - 53
PB  - Science Publishing Group
SN  - 2578-9686
UR  - https://doi.org/10.11648/j.ijmb.20240903.11
AB  - Potato brown rot was classified as a quarantine disease because of the complexity of the pathogen Ralstonia solanacearum L., formerly called Pseudonomas or Burkholderia solanacearum. This same bacterium causes the disease bacterial wilt. It is a multifaceted bacterium hence the complex name Ralstonia solanacearum (CeRs or RASLSSO) or BW (in English). It attacks several plant families, notably nightshades such as potatoes; the tomato; eggplant; chili pepper; tobacco…etc. The potato is the most cultivated plant worldwide. Mali is the second largest producer in West Africa after Nigeria. It imports more than 9,000 to 11,000 tons of seeds each year. Potato cultivation is faced with several biotic and abiotic attacks. Among all these attacks, those caused by bacteria cause the most significant damage. In addition, diseases caused mainly by the Ralstonia solanacearum complex lack adequate control solutions. Despite everything, today, very few studies are carried out to identify these bacteria in order to prevent their spread in the soil in Mali. This is why the objective of this study is to identify the bacteria responsible for brown rot in potato seeds in Mali. To achieve our objective, a total of 63 samples were taken from nine varieties of imported and locally multiplied potato seeds. The agent responsible for brown rot was isolated on the Triphenyl-Tetrazolium-chloride culture medium, and several microbiological, biochemical and molecular tests were carried out to identify the different isolates selected. As the main results of this study: twenty-seven bacterial isolates, capable of causing brown rot of potato seeds were isolated, the biochemical tests carried out on these isolates showed that they all of race3 and twenty -four isolates were biovar 3; one from biovar 2 and two from biovar 6. The molecular studies carried out using universal primers confirmed the presence of the species Ralstonia solanacearum with two phylotypes (I and II).

VL  - 9
IS  - 3
ER  -

    Copy | Download

Author Information

  • Binta Diallo

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali; Plant Seed Certification Laboratory, The Legislation and Phytosanitary Control Division, The National Directorate of Agriculture, Bamako, Mali

  • Adounigna Kassogué

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali

  • Rokiatou Fané

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali

  • Moctar Coulibaly

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali

  • Sognan Dao

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali

  • Ibrahima Mallé

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali

  • Amadou Hamadoun Babana

    Microbiology and Microbial Biotechnology Research Laboratory (LaboREM-Biotech), Faculty of Science and Technology (FST), The University of Bamako, Bamako, Mali

Download PDF
  • Abstract
  • Keywords

  • Document Sections

    1. 1. Introduction
    2. 2. Material and Methods
    3. 3. Results
    4. 4. Discussion
    5. 5. Conclusion
    Show Full Outline
  • Abbreviations
  • Acknowledgments
  • Conflicts of Interest
  • References
  • Cite This Article
  • Author Information

About Us

Science Publishing Group (SciencePG) is an Open Access publisher, with more than 300 online, peer-reviewed journals covering a wide range of academic disciplines.

Learn More About SciencePG

Products

Information

Important Link

Copyright © 2012 -- 2025 Science Publishing Group – All rights reserved.